{{Short description|Region of repetitive nucleotide sequences on chromosomes}} {{About||the use of "telomere" in insect morphology|Telomere (insect morphology)|other uses|}} [[File:Telomere caps.gif|thumb|right|300px|Human chromosomes (grey) capped by telomeres (white)]]

A '''telomere''' ({{IPAc-en|ˈ|t|ɛ|l|ə|m|ɪər|,_|ˈ|t|iː|l|ə|-}}; {{etymology|grc|''{{wikt-lang|grc|τέλος}}'' ({{grc-transl|τέλος}})|end||''{{wikt-lang|grc|μέρος}}'' ({{grc-transl|μέρος}})|part}}) is a region of repetitive nucleotide sequences associated with specialized proteins at the ends of linear chromosomes (see Sequences). Telomeres are a widespread genetic feature most commonly found in eukaryotes. In most or even all species possessing them, they protect the terminal regions of chromosomal DNA from progressive degradation and ensure the integrity of linear chromosomes by preventing DNA repair systems from mistaking the very ends of the DNA strand for a double-strand break.

== Discovery == The existence of a special structure at the ends of chromosomes was independently proposed in 1938 by Hermann Joseph Muller, studying the fruit fly ''Drosophila melanogaster'', and in 1939 by Barbara McClintock, working with maize.<ref>{{Cite journal |last1=Varela |first1=E. |last2=Blasco |first2=M. A. |date=March 2010 |title=2009 Nobel Prize in Physiology or Medicine: telomeres and telomerase |url=https://www.nature.com/articles/onc201015 |journal=Oncogene |language=en |volume=29 |issue=11 |pages=1561–1565 |doi=10.1038/onc.2010.15 |pmid=20237481 |s2cid=11726588 |issn=1476-5594|url-access=subscription }}</ref> Painter and Muller determined during 1929 two alternative possibilities for the order of chromosome rearrangement, the latter termed the "breakage-first hypothesis". Muller inferred from this hypothesis that for the continued operation of a broken ended chromosome, in radiation damaged chromosome of ''D. melanogaster'', the function of the terminal gene was to seal the break. He termed this gene a "telomere",<ref>{{cite journal|last=Muller |url=https://www.biodiversitylibrary.org/item/55303#page/186/mode/1up|first=H.J.|title=The Remaking of Chromosomes |location=Institute of Animal Genetics, Edinburgh University: Marine Biological Laboratory September 1|journal=The Collecting Net|volume=XIII|number=8|date=3 September 1938 |pages=192 (181, 183 - 195, 198)|quote=(p. 190) ''IV. On the Mechanism of Rearrangement'' What is the order of events when the exchange between non-homologous chromosome parts takes place? Nine years ago two general possibilities with regard to the mechanism of chromosome change had presented themselves that seeemed to be alternative (Painter and Muller, 1929). Two chromosome parts that were to undergo rearrangement with one another might come into contact, perhaps even fuse first, at the points where they were to undergo breakage, and then break, the breaks thus having a common cause, as must be true in crossing over. Or they might break first, perhaps independently of one another, and the broken ends, being somehow adhesive, might later find and fuse with the parts which they were to be attached to...(p.192) if we accept the breakage-first hypothesis, we must infer that fragments, even though provided with a centromere, die if their ends are broken ends, i.e. if their ends do not consist of a natural termini, derived from the same or another chromosome. The conclusion can therefore be drawn, if the breakage first hypothesis is valid, that the terminal gene must have a special function, that of sealing the end of the chromosome, so to speak, and for some reason a chromosome cannot persist indefinately without having its ends thus "sealed". This gene may accordingly be distinguished by a special term, the "telomere" (applied by myself and Darlington, and by Haldane, independently). }}</ref> from the Greek ''telos'' (end) and ''meros'' (part).

In the early 1970s, Soviet theorist Alexey Olovnikov first recognized that chromosomes could not completely replicate their ends; this is known as the "end replication problem". Building on this, and accommodating Leonard Hayflick's idea of limited somatic cell division, Olovnikov suggested that DNA sequences are lost every time a cell replicates until the loss reaches a critical level, at which point cell division ends.<ref>{{Cite journal |last=Olovnikov |first=A. M. |date=1971 |title=[Principle of marginotomy in template synthesis of polynucleotides] |journal=Doklady Akademii Nauk SSSR |volume=201 |issue=6 |pages=1496–1499 |issn=0002-3264 |pmid=5158754}}</ref><ref>{{Cite journal |last=Olovnikov |first=A. M. |date=1973-09-14 |title=A theory of marginotomy: The incomplete copying of template margin in enzymic synthesis of polynucleotides and biological significance of the phenomenon |journal=Journal of Theoretical Biology |language=en |volume=41 |issue=1 |pages=181–190 |doi=10.1016/0022-5193(73)90198-7 |pmid=4754905 |bibcode=1973JThBi..41..181O |issn=0022-5193}}</ref><ref>{{Cite journal |last=Olovnikov |first=A. M. |date=1996 |title=Telomeres, telomerase, and aging: origin of the theory |journal=Experimental Gerontology |volume=31 |issue=4 |pages=443–448 |doi=10.1016/0531-5565(96)00005-8 |issn=0531-5565 |pmid=9415101|s2cid=26381790 }}</ref> According to his theory of marginotomy, DNA sequences at the ends of telomeres are represented by tandem repeats, which create a buffer that determines the number of divisions that a certain cell clone can undergo. Furthermore, it was predicted that a specialized DNA polymerase (originally called a tandem-DNA-polymerase) could extend telomeres in immortal tissues such as germ line, cancer cells and stem cells. It also followed from this hypothesis that organisms with circular genome, such as bacteria, do not have the end replication problem and therefore do not age.

Olovnikov suggested that in germline cells, cells of vegetatively propagated organisms, and immortal cell populations such as most cancer cell lines, an enzyme might be activated to prevent the shortening of DNA termini with each cell division.<ref>{{Cite journal |last=Olovnikov |first=I. A. |date=2023 |title=[«He always talked about something else…» Alexey Matveyevich Olovnikov and his unusual science.] |journal=Advances in Gerontology = Uspekhi Gerontologii |volume=36 |issue=2 |pages=162–167 |doi=10.34922/AE.2023.36.2.001 |doi-broken-date=31 May 2026 |issn=1561-9125 |pmid=37356090}}</ref><ref>{{Cite web |title=Library Index |url=https://olovnikov.com/library/libraryindex.php |access-date=2024-10-13 |website=olovnikov.com}}</ref>

In 1975–1977, Elizabeth Blackburn, working as a postdoctoral fellow at Yale University with Joseph G. Gall, discovered the unusual nature of telomeres, with their simple repeated DNA sequences composing chromosome ends.<ref name=":0">{{cite journal | vauthors = Blackburn EH, Gall JG | title = A tandemly repeated sequence at the termini of the extrachromosomal ribosomal RNA genes in Tetrahymena | journal = Journal of Molecular Biology | volume = 120 | issue = 1 | pages = 33–53 | date = March 1978 | pmid = 642006 | doi = 10.1016/0022-2836(78)90294-2 | bibcode = 1978JMBio.120...33B }}</ref> Blackburn, Carol Greider, and Jack Szostak were awarded the 2009 Nobel Prize in Physiology or Medicine for the discovery of how chromosomes are protected by telomeres and the enzyme telomerase.<ref>{{cite web|url=http://nobelprize.org/nobel_prizes/medicine/laureates/2009/press.html |title=Elizabeth H. Blackburn, Carol W. Greider, Jack W. Szostak: The Nobel Prize in Physiology or Medicine 2009 |publisher=Nobel Foundation |date=2009-10-05 |access-date=2012-06-12}}</ref>

== Structure and function ==

=== End replication problem === {{Main|DNA replication}} thumb|250 px|Lagging strand during DNA replication

During DNA replication, DNA polymerase cannot replicate the sequences present at the 3' ends of the parent strands. This is a consequence of its unidirectional mode of DNA synthesis: it can only attach new nucleotides to an existing 3'-end (that is, synthesis progresses 5'-3') and thus it requires a primer to initiate replication. On the leading strand (oriented 5'-3' within the replication fork), DNA-polymerase continuously replicates from the point of initiation all the way to the strand's end with the primer (made of RNA) then being excised and substituted by DNA. The lagging strand, however, is oriented 3'-5' with respect to the replication fork so continuous replication by DNA-polymerase is impossible, which necessitates discontinuous replication involving the repeated synthesis of primers further 5' of the site of initiation (see lagging strand replication). The last primer to be involved in lagging-strand replication sits near the 3'-end of the template (corresponding to the potential 5'-end of the lagging-strand). Originally it was believed that the last primer would sit at the very end of the template, thus, once removed, the DNA-polymerase that substitutes primers with DNA (DNA-Pol δ in eukaryotes){{refn|group=note|name=note1|During replication, multiple DNA-polymerases are involved.}} would be unable to synthesize the "replacement DNA" from the 5'-end of the lagging strand so that the template nucleotides previously paired to the last primer would not be replicated.<ref>{{cite journal |vauthors=Olovnikov AM |title=A theory of marginotomy. The incomplete copying of template margin in enzymic synthesis of polynucleotides and biological significance of the phenomenon |journal=Journal of Theoretical Biology |volume=41 |issue=1 |pages=181–90 |date=September 1973 |pmid=4754905 |doi=10.1016/0022-5193(73)90198-7 |bibcode=1973JThBi..41..181O}}</ref> It has since been questioned whether the last lagging strand primer is placed exactly at the 3'-end of the template and it was demonstrated that it is rather synthesized at a distance of about 70–100 nucleotides which is consistent with the finding that DNA in cultured human cell is shortened by 50–100 base pairs per cell division.<ref>{{cite journal |vauthors=Chow TT, Zhao Y, Mak SS, Shay JW, Wright WE |title=Early and late steps in telomere overhang processing in normal human cells: the position of the final RNA primer drives telomere shortening |journal=Genes & Development |volume=26 |issue=11 |pages=1167–1178 |date=June 2012 |pmid=22661228 |pmc=3371406 |doi=10.1101/gad.187211.112}}</ref>

If coding sequences are degraded in this process, potentially vital genetic information would be lost. Telomeres are non-coding, repetitive sequences located at the termini of linear chromosomes to act as buffers for those coding sequences further behind. They "cap" the end-sequences and are progressively degraded in the process of DNA replication.

The "end replication problem" is exclusive to linear chromosomes as circular chromosomes do not have ends lying without reach of DNA-polymerases. Most prokaryotes, relying on circular chromosomes, accordingly do not possess telomeres.<ref>{{Cite book |first1=David L. |last1=Nelson |first2=Albert L. |last2=Lehninger |first3=Michael M. |last3=Cox |name-list-style=vanc |title=Lehninger Principles of Biochemistry |date=2008|publisher=W.H. Freeman |isbn=978-0-7167-7108-1 |edition=5th |location=New York |oclc=191854286 |url-access=registration |url=https://archive.org/details/lehningerprincip00lehn_1}}</ref> A small fraction of bacterial chromosomes (such as those in ''Streptomyces'', ''Agrobacterium'', and ''Borrelia''), however, are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and function. The known structures of bacterial telomeres take the form of proteins bound to the ends of linear chromosomes, or hairpin loops of single-stranded DNA at the ends of the linear chromosomes.<ref>{{cite web |url= http://www.sci.sdsu.edu/~smaloy/MicrobialGenetics/topics/chroms-genes-prots/chromosomes.html |title=Bacterial Chromosome Structure |last=Maloy|first=Stanley |name-list-style=vanc |date=July 12, 2002 |access-date=2008-06-22}}</ref>

=== Telomere ends and shelterin === thumb|300x300px|Shelterin co-ordinates the T-loop formation of telomeres. {{Main|Shelterin}}

At the very 3'-end of the telomere there is a 300 base pair overhang which can invade the double-stranded portion of the telomere forming a structure known as a T-loop. This loop is analogous to a knot, which stabilizes the telomere, and prevents the telomere ends from being recognized as breakpoints by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion would result. The T-loop is maintained by several proteins, collectively referred to as the shelterin complex. In humans, the shelterin complex consists of six proteins identified as TRF1, TRF2, TIN2, POT1, TPP1, and RAP1.<ref name="pmid20569239">{{cite journal | vauthors = Martínez P, Blasco MA | title = Role of shelterin in cancer and aging | journal = Aging Cell | volume = 9 | issue = 5 | pages = 653–66 | date = October 2010 | pmid = 20569239 | doi = 10.1111/j.1474-9726.2010.00596.x | doi-access = free }}</ref> In many species, the sequence repeats are enriched in guanine, e.g. TTAGGG in vertebrates,<ref name=pmid2780561>{{cite journal | vauthors = Meyne J, Ratliff RL, Moyzis RK | title = Conservation of the human telomere sequence (TTAGGG)n among vertebrates | journal = Proceedings of the National Academy of Sciences of the United States of America | volume = 86 | issue = 18 | pages = 7049–53 | date = September 1989 | pmid = 2780561 | pmc = 297991 | doi = 10.1073/pnas.86.18.7049 | bibcode = 1989PNAS...86.7049M | doi-access = free }}</ref> which allows the formation of G-quadruplexes, a special conformation of DNA involving non-Watson-Crick base pairing. There are different subtypes depending on the involvement of single- or double-stranded DNA, among other things. There is evidence for the 3'-overhang in ciliates (that possess telomere repeats similar to those found in vertebrates) to form such G-quadruplexes that accommodate it, rather than a T-loop. G-quadruplexes present an obstacle for enzymes such as DNA-polymerases and are thus thought to be involved in the regulation of replication and transcription.<ref>{{cite journal | vauthors = Lipps HJ, Rhodes D | title = G-quadruplex structures: in vivo evidence and function | journal = Trends in Cell Biology | volume = 19 | issue = 8 | pages = 414–22 | date = August 2009 | pmid = 19589679 | doi = 10.1016/j.tcb.2009.05.002 }}</ref>

=== Telomerase === thumb|Synthesis of chromosome ends by telomerase {{Main|Telomerase}}

Many organisms have a ribonucleoprotein enzyme called telomerase, which carries out the task of adding repetitive nucleotide sequences to the ends of the DNA. Telomerase "replenishes" the telomere "cap" and requires no ATP.<ref name=":2">{{cite journal |vauthors=Mender I, Shay JW |date=November 2015 |title=Telomerase Repeated Amplification Protocol (TRAP) |journal=Bio-Protocol |volume=5 |issue=22 |article-number=e1657 |doi=10.21769/bioprotoc.1657 |pmc=4863463 |pmid=27182535}}</ref> In most multicellular eukaryotic organisms, telomerase is active only in germ cells, some types of stem cells such as embryonic stem cells, and certain white blood cells. Telomerase can be reactivated and telomeres reset back to an embryonic state by somatic cell nuclear transfer.<ref>{{cite journal | vauthors = Lanza RP, Cibelli JB, Blackwell C, Cristofalo VJ, Francis MK, Baerlocher GM, Mak J, Schertzer M, Chavez EA, Sawyer N, Lansdorp PM, West MD | s2cid = 37387314 | display-authors = 6 | title = Extension of cell life-span and telomere length in animals cloned from senescent somatic cells | journal = Science | volume = 288 | issue = 5466 | pages = 665–9 | date = April 2000 | pmid = 10784448 | doi = 10.1126/science.288.5466.665 | bibcode = 2000Sci...288..665L }}</ref> The steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence<ref name="WhittemoreVera2019">{{cite journal|last1=Whittemore|first1=Kurt|last2=Vera|first2=Elsa|last3=Martínez-Nevado|first3=Eva|last4=Sanpera|first4=Carola|last5=Blasco|first5=Maria A.|title=Telomere shortening rate predicts species life span|journal=Proceedings of the National Academy of Sciences|volume=116|issue=30|year=2019|pages=15122–15127|issn=0027-8424|doi=10.1073/pnas.1902452116|pmid=31285335|pmc=6660761|bibcode=2019PNAS..11615122W |doi-access=free}}</ref> and in the prevention of cancer.<ref>{{cite journal | vauthors = Shay JW, Wright WE | title = Senescence and immortalization: role of telomeres and telomerase | journal = Carcinogenesis | volume = 26 | issue = 5 | pages = 867–74 | date = May 2005 | pmid = 15471900 | doi = 10.1093/carcin/bgh296 | doi-access = free }}</ref><ref>{{cite journal | vauthors = Wai LK | title = Telomeres, telomerase, and tumorigenesis--a review | journal = MedGenMed | volume = 6 | issue = 3 | page = 19 | date = July 2004 | pmid = 15520642 | pmc = 1435592 }}</ref> This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions.<ref>{{cite journal | vauthors = Greider CW | title = Telomeres, telomerase and senescence | journal = BioEssays | volume = 12 | issue = 8 | pages = 363–9 | date = August 1990 | pmid = 2241933 | doi = 10.1002/bies.950120803 | s2cid = 11920124 | doi-access = free }}</ref><ref>Barnes, R.P., de Rosa, M., Thosar, S.A., et al., ''[https://www.nature.com/articles/s41594-022-00790-y Telomeric 8-oxo-guanine drives rapid premature senescence in the absence of telomere shortening]'', Nature, June 30, 2022; Nat Struct Mol Biol 29, 639–652 (2022). https://doi.org/10.1038/s41594-022-00790-y</ref>

=== Length ===

Telomere length varies greatly between species, from approximately 300 base pairs in yeast<ref>{{cite journal | vauthors = Shampay J, Szostak JW, Blackburn EH | s2cid = 4360698 | title = DNA sequences of telomeres maintained in yeast | journal = Nature | volume = 310 | issue = 5973 | pages = 154–7 | year = 1984 | pmid = 6330571 | doi = 10.1038/310154a0 | bibcode = 1984Natur.310..154S }}</ref> to many kilobases in humans, and usually is composed of arrays of guanine-rich, six- to eight-base-pair-long repeats. Eukaryotic telomeres normally terminate with 3′ single-stranded-DNA overhang ranging from 75 to 300 bases, which is essential for telomere maintenance and capping. Multiple proteins binding single- and double-stranded telomere DNA have been identified.<ref>{{cite journal | vauthors = Williams TL, Levy DL, Maki-Yonekura S, Yonekura K, Blackburn EH | title = Characterization of the yeast telomere nucleoprotein core: Rap1 binds independently to each recognition site | journal = The Journal of Biological Chemistry | volume = 285 | issue = 46 | pages = 35814–24 | date = November 2010 | pmid = 20826803 | pmc = 2975205 | doi = 10.1074/jbc.M110.170167 | doi-access = free }}</ref> These function in both telomere maintenance and capping. Telomeres form large loop structures called telomere loops, or T-loops. Here, the single-stranded DNA curls around in a long circle, stabilized by telomere-binding proteins.<ref>{{cite journal | vauthors = Griffith JD, Comeau L, Rosenfield S, Stansel RM, Bianchi A, Moss H, de Lange T | s2cid = 721901 | title = Mammalian telomeres end in a large duplex loop | journal = Cell | volume = 97 | issue = 4 | pages = 503–14 | date = May 1999 | pmid = 10338214 | doi = 10.1016/S0092-8674(00)80760-6 | bibcode = 1999Cell...97..503G | doi-access = free }}</ref> At the very end of the T-loop, the single-stranded telomere DNA is held onto a region of double-stranded DNA by the telomere strand disrupting the double-helical DNA, and base pairing to one of the two strands. This triple-stranded structure is called a displacement loop or D-loop.<ref>{{cite journal | vauthors = Burge S, Parkinson GN, Hazel P, Todd AK, Neidle S | title = Quadruplex DNA: sequence, topology and structure | journal = Nucleic Acids Research | volume = 34 | issue = 19 | pages = 5402–15 | year = 2006 | pmid = 17012276 | pmc = 1636468 | doi = 10.1093/nar/gkl655 }}</ref> A recent 2025 study suggest individuals with higher vitamin D intake may experience a slower rate of cellular aging.<ref>{{Cite journal |last1=Zhu |first1=Haidong |last2=Manson |first2=JoAnn E. |last3=Cook |first3=Nancy R. |last4=Bekele |first4=Bayu B. |last5=Chen |first5=Li |last6=Kane |first6=Kevin J. |last7=Huang |first7=Ying |last8=Li |first8=Wenjun |last9=Christen |first9=William |last10=Lee |first10=I.-Min |last11=Dong |first11=Yanbin |date=2025-05-21 |title=Vitamin D3 and Marine Omega-3 Fatty Acids Supplementation and Leukocyte Telomere Length: 4-Year Findings from the VITAL Randomized Controlled Trial |url=https://ajcn.nutrition.org/article/S0002-9165(25)00255-2/abstract |journal=The American Journal of Clinical Nutrition |issue=1 |pages=39–47 |language=English |volume=122 |doi=10.1016/j.ajcnut.2025.05.003 |issn=0002-9165 |pmid=40409468 |pmc=12308094 }}</ref> The study found that vitamin D supplements could help reduce this shortening, potentially by lowering inflammation. However, scientists caution that vitamin D is not a universal remedy, as it does not appear to impact all chronic illnesses.<ref>{{Cite news |last=Chesler |first=Caren |date=2025-05-22 |title=Vitamin D may slow a process related to aging, new study suggests |url=https://www.washingtonpost.com/wellness/2025/05/22/vitamin-d-aging-telomere-study/ |access-date=2025-05-24 |newspaper=The Washington Post |language=en-US |issn=0190-8286}}</ref>

== Shortening ==

=== Oxidative damage ===

Apart from the end replication problem, in vitro studies have shown that telomeres accumulate damage due to oxidative stress and that oxidative stress-mediated DNA damage has a major influence on telomere shortening in vivo. There is a multitude of ways in which oxidative stress, mediated by reactive oxygen species (ROS), can lead to DNA damage; however, it is yet unclear whether the elevated rate in telomeres is brought about by their inherent susceptibility or a diminished activity of DNA repair systems in these regions.<ref>{{Cite journal|vauthors=Barnes R, Fouquerel E, Opresko P|date=2019|title=The impact of oxidative DNA damage and stress on telomere homeostasis |journal=Mechanisms of Ageing and Development|volume=177|pages=37–45|doi=10.1016/j.mad.2018.03.013|pmid=29604323|pmc=6162185}}</ref> Despite widespread agreement of the findings, widespread flaws regarding measurement and sampling have been pointed out; for example, a suspected species and tissue dependency of oxidative damage to telomeres is said to be insufficiently accounted for.<ref>{{cite journal | vauthors = Reichert S, Stier A | title = Does oxidative stress shorten telomeres ''in vivo''? A review | journal = Biology Letters | volume = 13 | issue = 12 | article-number = 20170463 | date = December 2017 | pmid = 29212750 | pmc = 5746531 | doi = 10.1098/rsbl.2017.0463 | bibcode = 2017BiLet..1370463R }}</ref> Population-based studies have indicated an interaction between anti-oxidant intake and telomere length. In the Long Island Breast Cancer Study Project (LIBCSP), authors found a moderate increase in breast cancer risk among women with the shortest telomeres and lower dietary intake of beta carotene, vitamin C or E.<ref>{{cite journal | vauthors = Shen J, Gammon MD, Terry MB, Wang Q, Bradshaw P, Teitelbaum SL, Neugut AI, Santella RM | display-authors = 6 | title = Telomere length, oxidative damage, antioxidants and breast cancer risk | journal = International Journal of Cancer | volume = 124 | issue = 7 | pages = 1637–43 | date = April 2009 | pmid = 19089916 | pmc = 2727686 | doi = 10.1002/ijc.24105 }}</ref> These results <ref name="Mathur MB 2016">{{cite journal | vauthors = Mathur MB, Epel E, Kind S, Desai M, Parks CG, Sandler DP, Khazeni N | title = Perceived stress and telomere length: A systematic review, meta-analysis, and methodologic considerations for advancing the field | journal = Brain, Behavior, and Immunity | volume = 54 | pages = 158–169 | date = May 2016 | pmid = 26853993 | pmc = 5590630 | doi = 10.1016/j.bbi.2016.02.002 }}</ref> suggest that cancer risk due to telomere shortening may interact with other mechanisms of DNA damage, specifically oxidative stress.

=== Association with aging === {{Main article|Relationship between telomeres and longevity}}

Although telomeres shorten during the lifetime of an individual, it is telomere shortening-rate rather than telomere length that is associated with the human lifespan.<ref name="pmid35165420" /> Critically short telomeres trigger a DNA damage response and cellular senescence.<ref name="pmid35165420" /> Mice have much longer telomeres, but a greatly accelerated telomere shortening-rate and greatly reduced lifespan compared to humans and elephants.<ref name="pmid33504179">{{cite journal | vauthors = Hoffmann J, Richardson G, Spyridopoulos I | title = Telomerase as a Therapeutic Target in Cardiovascular Disease | journal = Arteriosclerosis, Thrombosis, and Vascular Biology | volume = 41 | issue=3 | pages = 1047–1061 | date=2021 | doi = 10.1161/ATVBAHA.120.315695 | pmid = 33504179| doi-access = free }}</ref>

Telomere shortening is associated with aging, mortality, and aging-related diseases in experimental animals.<ref name=":0" /><ref>{{cite journal | vauthors = Aston KI, Hunt SC, Susser E, Kimura M, Factor-Litvak P, Carrell D, Aviv A | title = Divergence of sperm and leukocyte age-dependent telomere dynamics: implications for male-driven evolution of telomere length in humans | journal = Molecular Human Reproduction | volume = 18 | issue = 11 | pages = 517–22 | date = November 2012 | pmid = 22782639 | pmc = 3480822 | doi = 10.1093/molehr/gas028 | url = }}</ref> Although many factors can affect human lifespan, such as smoking, diet, and exercise, as persons approach the upper limit of human life expectancy, longer telomeres may be associated with lifespan.<ref name="pmid28394764">{{cite journal | vauthors = Steenstrup T, Kark JD, Aviv A | title = Telomeres and the natural lifespan limit in humans | journal = Aging | volume = 9 | issue=4 | pages = 130–1142 | date=2017 | doi = 10.18632/aging.101216 | pmc=5425118 | pmid = 28394764}}</ref> However, vitamin D3 supplementation has been shown to significantly reduce telomere shortening over four years compared to a placebo, thus preventing nearly three years' worth of cellular aging,<ref>{{Cite journal |last1=Zhu |first1=Haidong |last2=Manson |first2=JoAnn E. |last3=Cook |first3=Nancy R. |last4=Bekele |first4=Bayu B. |last5=Chen |first5=Li |last6=Kane |first6=Kevin J. |last7=Huang |first7=Ying |last8=Li |first8=Wenjun |last9=Christen |first9=William |last10=Lee |first10=I-Min |last11=Dong |first11=Yanbin |date=2025-05-21 |title=Vitamin D3 and Marine Omega-3 Fatty Acids Supplementation and Leukocyte Telomere Length: 4-Year Findings from the VITAL Randomized Controlled Trial |journal=The American Journal of Clinical Nutrition |volume=122 |issue=1 |pages=39–47 |doi=10.1016/j.ajcnut.2025.05.003 |pmid=40409468 |pmc=12308094 |issn=0002-9165}}</ref> which may help offset telomere truncation over time.

=== Potential effect of psychological stress ===

Meta-analyses found that increased perceived psychological stress was associated with a small decrease in telomere length&mdash;but that these associations attenuate to no significant association when accounting for publication bias. The literature concerning telomeres as integrative biomarkers of exposure to stress and adversity is dominated by cross-sectional and correlational studies, which makes causal interpretation problematic.<ref name="Mathur MB 2016"/><ref>{{cite journal | vauthors = Pepper GV, Bateson M, Nettle D | title = Telomeres as integrative markers of exposure to stress and adversity: a systematic review and meta-analysis | journal = Royal Society Open Science | volume = 5 | issue = 8 | article-number = 180744 | date = August 2018 | pmid = 30225068 | pmc = 6124068 | doi = 10.1098/rsos.180744 | doi-access = free| bibcode = 2018RSOS....580744P }}</ref> A 2020 review argued that the relationship between psychosocial stress and telomere length appears strongest for stress experienced in utero or early life.<ref>{{cite journal | vauthors = Rentscher KE, Carroll JE, Mitchell C | title = Psychosocial Stressors and Telomere Length: A Current Review of the Science | journal = Annual Review of Public Health | volume = 41 | pages = 223–245 | date = April 2020 | pmid = 31900099 | doi = 10.1146/annurev-publhealth-040119-094239 | s2cid = 209748557 | doi-access =free }}</ref>

== Lengthening == [[File:Hayflick Limit (1).svg|thumb|The average cell will divide between 50 and 70 times before cell death. As the cell divides the telomeres on the end of the chromosome get smaller. The Hayflick limit is the theoretical limit to the number of times a cell may divide until the telomere becomes so short that division is inhibited and the cell enters senescence.]] The phenomenon of limited cellular division was first observed by Leonard Hayflick, and is now referred to as the Hayflick limit.<ref name="pmid13905659">{{cite journal | vauthors = Hayflick L, Moorhead PS | title = The serial cultivation of human diploid cell strains | journal = Experimental Cell Research | volume = 25 | issue = 3 | pages = 585–621 | date = December 1961 | pmid = 13905658 | doi = 10.1016/0014-4827(61)90192-6 }}</ref><ref>{{cite journal | vauthors = Hayflick L | title = The limited in vitro lifetime of human diploid cell strains | journal = Experimental Cell Research | volume = 37 | issue = 3 | pages = 614–36 | date = March 1965 | pmid = 14315085 | doi = 10.1016/0014-4827(65)90211-9 }}</ref> Significant discoveries were subsequently made by a group of scientists organized at Geron Corporation by Geron's founder Michael D. West, that tied telomere shortening with the Hayflick limit.<ref name="pmid7544491">{{cite journal | vauthors = Feng J, Funk WD, Wang SS, Weinrich SL, Avilion AA, Chiu CP, Adams RR, Chang E, Allsopp RC, Yu J | display-authors = 6 | title = The RNA component of human telomerase | journal = Science | volume = 269 | issue = 5228 | pages = 1236–41 | date = September 1995 | pmid = 7544491 | doi = 10.1126/science.7544491 | bibcode = 1995Sci...269.1236F | s2cid = 9440710 }}</ref> The cloning of the catalytic component of telomerase enabled experiments to test whether the expression of telomerase at levels sufficient to prevent telomere shortening was capable of immortalizing human cells. Telomerase was demonstrated in a 1998 publication in ''Science'' to be capable of extending cell lifespan, and now is well-recognized as capable of immortalizing human somatic cells.<ref>{{cite journal | vauthors = Bodnar AG, Ouellette M, Frolkis M, Holt SE, Chiu CP, Morin GB, Harley CB, Shay JW, Lichtsteiner S, Wright WE | s2cid = 35667874 | display-authors = 6 | title = Extension of life-span by introduction of telomerase into normal human cells | journal = Science | volume = 279 | issue = 5349 | pages = 349–52 | date = January 1998 | pmid = 9454332 | doi = 10.1126/science.279.5349.349 | bibcode = 1998Sci...279..349B }}</ref>

Two studies on long-lived seabirds demonstrate that the role of telomeres is far from being understood. In 2003, scientists observed that the telomeres of Leach's storm-petrel (''Oceanodroma leucorhoa'') seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres.<ref>{{cite journal | vauthors = Nakagawa S, Gemmell NJ, Burke T | title = Measuring vertebrate telomeres: applications and limitations | journal = Molecular Ecology | volume = 13 | issue = 9 | pages = 2523–33 | date = September 2004 | pmid = 15315667 | doi = 10.1111/j.1365-294X.2004.02291.x | bibcode = 2004MolEc..13.2523N | s2cid = 13841086 | url = http://eprints.whiterose.ac.uk/353/1/burket16.pdf }}</ref>

A study reported that telomere length of different mammalian species correlates inversely rather than directly with lifespan, and concluded that the contribution of telomere length to lifespan remains controversial.<ref>{{cite journal | vauthors = Gomes NM, Ryder OA, Houck ML, Charter SJ, Walker W, Forsyth NR, Austad SN, Venditti C, Pagel M, Shay JW, Wright WE | display-authors = 6 | title = Comparative biology of mammalian telomeres: hypotheses on ancestral states and the roles of telomeres in longevity determination | journal = Aging Cell | volume = 10 | issue = 5 | pages = 761–8 | date = October 2011 | pmid = 21518243 | pmc = 3387546 | doi = 10.1111/j.1474-9726.2011.00718.x }}</ref> There is little evidence that, in humans, telomere length is a significant biomarker of normal aging with respect to important cognitive and physical abilities.<ref>{{cite journal | vauthors = Harris SE, Martin-Ruiz C, von Zglinicki T, Starr JM, Deary IJ | s2cid = 10309423 | title = Telomere length and aging biomarkers in 70-year-olds: the Lothian Birth Cohort 1936 | journal = Neurobiology of Aging | volume = 33 | issue = 7 | pages = 1486.e3–8 | date = July 2012 | pmid = 21194798 | doi = 10.1016/j.neurobiolaging.2010.11.013 }}</ref>

== Sequences == Experimentally verified and predicted telomere sequence motifs from more than 9000 species are collected in research community curated database [http://cfb.ceitec.muni.cz/telobase/ TeloBase].<ref>{{Cite journal |last1=Lyčka |first1=Martin |last2=Bubeník |first2=Michal |last3=Závodník |first3=Michal |last4=Peska |first4=Vratislav |last5=Fajkus |first5=Petr |last6=Demko |first6=Martin |last7=Fajkus |first7=Jiří |last8=Fojtová |first8=Miloslava |date=2023-08-21 |title=TeloBase: a community-curated database of telomere sequences across the tree of life |journal=Nucleic Acids Research |volume=52 |issue=D1 |pages=D311–D321 |doi=10.1093/nar/gkad672 |issn=0305-1048 |pmc=10767889 |pmid=37602392}}</ref> Some of the experimentally verified telomere nucleotide sequences are also listed in [http://telomerase.asu.edu/sequences_telomere.html Telomerase Database] {{Webarchive|url=https://web.archive.org/web/20200220185938/http://telomerase.asu.edu/sequences_telomere.html |date=2020-02-20 }} website (see nucleic acid notation for letter representations).

{| class="wikitable" |+ Some known telomere nucleotide sequences |- ! Group ! Organism ! Telomeric repeat (5' to 3' toward the end) |- | Vertebrates | Human, mouse, ''Xenopus'' | TTAGGG |- | Filamentous fungi | ''Neurospora crassa'' | TTAGGG |- |rowspan="2"| Slime moulds | ''Physarum'', ''Didymium'' | TTAGGG |- | ''Dictyostelium'' | AG(1-8) |- | Kinetoplastid protozoa | ''Trypanosoma'', ''Crithidia'' | TTAGGG |- |rowspan="3"| Ciliate protozoa | ''Tetrahymena'', ''Glaucoma'' | TTGGGG |- | ''Paramecium'' | TTGGG(T/G) |- | ''Oxytricha'', ''Stylonychia'', ''Euplotes'' | TTTTGGGG |- | Apicomplexan protozoa | ''Plasmodium'' | TTAGGG(T/C) |- |rowspan="4"| Higher plants | ''Arabidopsis thaliana'' | TTTAGGG |- | ''Cestrum elegans'' | TTTTTTAGGG<ref name=Peska2015>{{cite journal | vauthors = Peška V, Fajkus P, Fojtová M, Dvořáčková M, Hapala J, Dvořáček V, Polanská P, Leitch AR, Sýkorová E, Fajkus J | display-authors = 6 | title = Characterisation of an unusual telomere motif (TTTTTTAGGG)n in the plant Cestrum elegans (Solanaceae), a species with a large genome | journal = The Plant Journal | volume = 82 | issue = 4 | pages = 644–54 | date = May 2015 | pmid = 25828846 | doi = 10.1111/tpj.12839 | doi-access = free }}</ref> |- | ''Allium'' | CTCGGTTATGGG<ref name="Fajkus2016">{{cite journal | vauthors = Fajkus P, Peška V, Sitová Z, Fulnečková J, Dvořáčková M, Gogela R, Sýkorová E, Hapala J, Fajkus J | s2cid = 206331112 | display-authors = 6 | title = Allium telomeres unmasked: the unusual telomeric sequence (CTCGGTTATGGG)n is synthesized by telomerase | journal = The Plant Journal | volume = 85 | issue = 3 | pages = 337–47 | date = February 2016 | pmid = 26716914 | doi = 10.1111/tpj.13115 | doi-access = free }}</ref> |- | Green algae ''Chlamydomonas'' | TTTTAGGG |- | rowspan="3" | Insects | ''Bombyx mori'' | TTAGG |- |''Bombus terrestris'' |TTAGGTTGGGG<ref name=":3">{{Cite journal |last1=Fajkus |first1=Petr |last2=Adámik |first2=Matej |last3=Nelson |first3=Andrew D L |last4=Kilar |first4=Agata M |last5=Franek |first5=Michal |last6=Bubeník |first6=Michal |last7=Frydrychová |first7=Radmila Čapková |last8=Votavová |first8=Alena |last9=Sýkorová |first9=Eva |last10=Fajkus |first10=Jiří |last11=Peška |first11=Vratislav |date=2023-01-11 |title=Telomerase RNA in Hymenoptera (Insecta) switched to plant/ciliate-like biogenesis |url=https://academic.oup.com/nar/article/51/1/420/6956357 |journal=Nucleic Acids Research |language=en |volume=51 |issue=1 |pages=420–433 |doi=10.1093/nar/gkac1202 |issn=0305-1048 |pmc=9841428 |pmid=36546771}}</ref> |- |''Vespula vulgaris'' |TTGCGTCTGGG<ref name=":3" /> |- | Roundworms | ''Ascaris lumbricoides'' | TTAGGC |- | Fission yeasts | ''Schizosaccharomyces pombe'' | TTAC(A)(C)G(1-8) |- |rowspan="9"| Budding yeasts | ''Saccharomyces cerevisiae'' | TGTGGGTGTGGTG (from RNA template)<br /> or G(2-3)(TG)(1-6)T (consensus) |- | ''Saccharomyces castellii'' | TCTGGGTG |- | ''Candida glabrata'' | GGGGTCTGGGTGCTG |- | ''Candida albicans'' | GGTGTACGGATGTCTAACTTCTT |- | ''Candida tropicalis'' | GGTGTA[C/A]GGATGTCACGATCATT |- | ''Candida maltosa'' | GGTGTACGGATGCAGACTCGCTT |- | ''Candida guillermondii'' | GGTGTAC |- | ''Candida pseudotropicalis'' | GGTGTACGGATTTGATTAGTTATGT |- | ''Kluyveromyces lactis'' | GGTGTACGGATTTGATTAGGTATGT |}

== Research on disease risk ==

Disease risk in aging may be associated with telomere shortening, senescent cells, or SASP (senescence-associated secretory phenotype).<ref name="pmid35165420">{{cite journal | vauthors = Rossiello F, Jurk D, Passos JF, di Fagagna F | title = Telomere dysfunction in ageing and age-related diseases | journal = Nature Cell Biology | volume = 24 | issue=2 | pages = 135–147 | date=2022 | doi = 10.1038/s41556-022-00842-x | pmc=8985209 | pmid = 35165420 | bibcode = 2022NaCB...24..135R }}</ref> Each time a cell divides, its telomeres shorten. After enough divisions, the telomeres are absent and the cell cannot divide, leading to senescence. Senescent cells are associated with aging, cancer and other ailments.<ref name="q812">{{cite web | title=Are Telomeres the Key to Aging and Cancer | website=Learn.Genetics | date=2026-01-07 | url=https://learn.genetics.utah.edu/content/basics/telomeres/ | access-date=2026-01-10}}</ref>

== Measurement ==

Several techniques are currently employed to assess average telomere length in eukaryotic cells. One method is the Terminal Restriction Fragment (TRF) southern blot.<ref>{{cite journal | vauthors = Allshire RC, Dempster M, Hastie ND | title = Human telomeres contain at least three types of G-rich repeat distributed non-randomly | journal = Nucleic Acids Research | volume = 17 | issue = 12 | pages = 4611–27 | date = June 1989 | pmid = 2664709 | pmc = 318019 | doi = 10.1093/nar/17.12.4611 | display-authors = 1 }}</ref><ref>{{cite journal | vauthors = Rufer N, Dragowska W, Thornbury G, Roosnek E, Lansdorp PM | s2cid = 23833545 | title = Telomere length dynamics in human lymphocyte subpopulations measured by flow cytometry | journal = Nature Biotechnology | volume = 16 | issue = 8 | pages = 743–7 | date = August 1998 | pmid = 9702772 | doi = 10.1038/nbt0898-743 | display-authors = 1 | bibcode = 1998NatBi..16..743R }}</ref> There is a Web-based Analyser of the Length of Telomeres ([https://www.ceitec.eu/chromatin-molecular-complexes/rg51/tab?tabId=125 WALTER]), software processing the TRF pictures.<ref>{{Cite journal |last1=Lyčka |first1=Martin |last2=Peska |first2=Vratislav |last3=Demko |first3=Martin |last4=Spyroglou |first4=Ioannis |last5=Kilar |first5=Agata |last6=Fajkus |first6=Jiří |last7=Fojtová |first7=Miloslava |date=December 2021 |title=WALTER: an easy way to online evaluate telomere lengths from terminal restriction fragment analysis |journal=BMC Bioinformatics |language=en |volume=22 |issue=1 |page=145 |doi=10.1186/s12859-021-04064-0 |doi-access=free |issn=1471-2105 |pmc=7986547 |pmid=33752601}}</ref> A Real-Time PCR assay for telomere length involves determining the Telomere-to-Single Copy Gene (T/S) ratio, which is demonstrated to be proportional to the average telomere length in a cell.<ref>{{cite journal | vauthors = Cawthon RM | title = Telomere measurement by quantitative PCR | journal = Nucleic Acids Research | volume = 30 | issue = 10 | pages = 47e–47 | date = May 2002 | pmid = 12000852 | pmc = 115301 | doi = 10.1093/nar/30.10.e47 }}</ref>

Tools have also been developed to estimate the length of telomere from whole genome sequencing (WGS) experiments. Amongst these are TelSeq,<ref>{{cite journal |doi= 10.1093/nar/gku181 |title=Estimating telomere length from whole genome sequence data |journal=Nucleic Acids Research |year=2014 | vauthors = Ding Z |volume=42 |issue=9 |pages=e75 |pmid=24609383 |pmc=4027178 }}</ref> Telomerecat<ref>{{cite journal |doi= 10.1038/s41598-017-14403-y |title=Telomerecat: A ploidy-agnostic method for estimating telomere length from whole genome sequencing data. |journal=Scientific Reports |year=2018 | vauthors = Farmery J |volume=8 |issue=1 |article-number=1300 |pmid=29358629 |pmc=5778012 |bibcode=2018NatSR...8.1300F }}</ref> and telomereHunter.<ref>{{cite journal |doi= 10.1186/s12859-019-2851-0 |title=TelomereHunter–in silico estimation of telomere content and composition from cancer genomes. |journal=BMC Bioinformatics |year=2019 | vauthors = Feuerbach L |volume=20 |issue=1 |article-number=272 |pmid=31138115 |pmc=6540518 |doi-access=free }}</ref> Length estimation from WGS typically works by differentiating telomere sequencing reads and then inferring the length of telomere that produced that number of reads. These methods have been shown to correlate with preexisting methods of estimation such as PCR and TRF. Flow-FISH is used to quantify the length of telomeres in human white blood cells. A semi-automated method for measuring the average length of telomeres with Flow FISH was published in Nature Protocols in 2006.<ref>{{cite journal | vauthors = Baerlocher GM, Vulto I, de Jong G, Lansdorp PM | title = Flow cytometry and FISH to measure the average length of telomeres (flow FISH) | journal = Nature Protocols | volume = 1 | issue = 5 | pages = 2365–76 | date = December 2006 | pmid = 17406480 | doi = 10.1038/nprot.2006.263 | s2cid = 20463557 }}</ref>

While multiple companies offer telomere length measurement services, the utility of these measurements for widespread clinical or personal use has been questioned.<ref>{{Cite news|url=https://www.nytimes.com/2011/05/19/business/19life.html|title=A Blood Test Offers Clues to Longevity|first=Andrew|last=Pollack|newspaper=The New York Times|date=May 18, 2011}}</ref><ref>{{cite journal | vauthors = von Zglinicki T | title = Will your telomeres tell your future? | journal = BMJ | volume = 344 | article-number = e1727 | date = March 2012 | pmid = 22415954 | doi = 10.1136/bmj.e1727 | s2cid = 44594597 }}</ref> Nobel Prize winner Elizabeth Blackburn, who was co-founder of one company, promoted the clinical utility of telomere length measures.<ref>{{cite journal |doi=10.1038/news.2011.330 |title=Spit test offers guide to health |journal=Nature |year=2011 | vauthors = Marchant J |doi-access=free }}</ref>

== In wildlife ==

During the last three decades, eco-evolutionary studies have investigated the relevance of life-history traits and environmental conditions on telomeres of wildlife. Most of these studies have been conducted in endotherms, i.e. birds and mammals. They have provided evidence for the inheritance of telomere length; however, heritability estimates vary greatly within and among species.<ref>{{Cite journal|last1=Dugdale|first1=Hannah L.|last2=Richardson|first2=David S.|date=2018-01-15|title=Heritability of telomere variation: it is all about the environment!|journal=Philosophical Transactions of the Royal Society B: Biological Sciences|volume=373|issue=1741|article-number=20160450|doi=10.1098/rstb.2016.0450|pmid=29335377|issn=0962-8436|pmc=5784070}}</ref> Age and telomere length often negatively correlate in vertebrates, but this decline is variable among taxa and is influenced by the method used for estimating telomere length.<ref>{{Cite journal|last1=Remot|first1=Florentin|last2=Ronget|first2=Victor|last3=Froy|first3=Hannah|last4=Rey|first4=Benjamin|last5=Gaillard|first5=Jean-Michel|last6=Nussey|first6=Daniel H.|last7=Lemaitre|first7=Jean-François|date=2021-09-07|title=Decline in telomere length with increasing age across nonhuman vertebrates: A meta-analysis|journal=Molecular Ecology|volume=31 |issue=23 |pages=5917–5932 |doi=10.1111/mec.16145|pmid=34437736|hdl=20.500.11820/91f3fc9e-4a69-4ac4-a8a0-45c93ccbf3b5 |s2cid=237328316 |issn=0962-1083|hdl-access=free}}</ref> In contrast, the available information shows no sex differences in telomere length across vertebrates.<ref>{{Cite journal|last1=Remot|first1=Florentin|last2=Ronget|first2=Victor|last3=Froy|first3=Hannah|last4=Rey|first4=Benjamin|last5=Gaillard|first5=Jean-Michel|last6=Nussey|first6=Daniel H.|last7=Lemaître|first7=Jean-François|date=November 2020|title=No sex differences in adult telomere length across vertebrates: a meta-analysis|journal=Royal Society Open Science|volume=7|issue=11|article-number=200548|doi=10.1098/rsos.200548|doi-access=free|pmid=33391781|pmc=7735339|bibcode=2020RSOS....700548R|s2cid=226291119|issn=2054-5703}}</ref> Phylogeny and life history traits such as body size or the pace of life can also affect telomere dynamics. For example, it has been described across species of birds and mammals.<ref>{{Cite journal |last1=Pepke |first1=Michael Le |last2=Eisenberg |first2=Dan T. A. |date=2021-03-16 |title=On the comparative biology of mammalian telomeres: Telomere length co-evolves with body mass, lifespan and cancer risk |journal=Molecular Ecology |volume=31 |issue=23 |language=en |pages=6286–6296 |doi=10.1111/mec.15870 |pmid=33662151 |issn=0962-1083|doi-access=free }}</ref> A meta-analysis has confirmed that exposure to various stressors (e.g. pathogen infection, competition, reproductive effort and high activity level) was associated with shorter telomeres across different animal taxa.<ref>{{Cite journal|last1=Chatelain|first1=Marion|last2=Drobniak|first2=Szymon M.|last3=Szulkin|first3=Marta|date=2019-11-27|title=The association between stressors and telomeres in non-human vertebrates: a meta-analysis|journal=Ecology Letters|volume=23|issue=2|pages=381–398|doi=10.1111/ele.13426|pmid=31773847|s2cid=208319503|issn=1461-023X|doi-access=free}}</ref>

Studies on ectotherms, and other non-mammalian organisms, show that there is no single universal model of telomere erosion; rather, there is wide variation in relevant dynamics across Metazoa, and even within smaller taxonomic groups these patterns appear diverse.<ref name=":1">{{cite journal | vauthors = Olsson M, Wapstra E, Friesen C | title = Ectothermic telomeres: it's time they came in from the cold | journal = Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences | volume = 373 | issue = 1741 | article-number = 20160449 | date = March 2018 | pmid = 29335373 | pmc = 5784069 | doi = 10.1098/rstb.2016.0449 }}</ref>

== See also == {{Portal|Biology}} *Epigenetic clock *Centromere *DNA damage theory of aging *Immortality *Maximum life span *Rejuvenation (aging) *Senescence, biological aging *Tankyrase *Telomere-binding protein *G-quartet *Immortal DNA strand hypothesis

== Notes == {{Reflist|group=note}}

== References == {{Reflist}}

== External links == {{Commons category|Telomeres}}

*[http://nobelprize.org/mediaplayer/index.php?id=1214 Telomeres and Telomerase: The Means to the End] Nobel Lecture by Elizabeth Blackburn, which includes a reference to the impact of stress, and pessimism on telomere length *[http://nobelprize.org/mediaplayer/index.php?id=1216 Telomerase and the Consequences of Telomere Dysfunction] Nobel Lecture by Carol Greider *[http://nobelprize.org/mediaplayer/index.php?id=1218 DNA Ends: Just the Beginning] Nobel Lecture by Jack Szostak

{{Chromosome genetics}} {{Biotechnology}} {{Repeated sequence}} {{Authority control}}

Category:Chromosomes Category:Molecular biology Category:Repetitive DNA sequences Category:Telomeres Category:Non-coding DNA