{{Short description|Mobile genetic element in the primate genome (including human genome)}} {{update|date=February 2021}}
An '''Alu element''' is a short stretch of DNA originally characterized by the action of the ''Arthrobacter luteus (Alu)'' restriction endonuclease.<ref name=pmid1052772>{{cite journal |doi=10.1016/0092-8674(75)90184-1 |pmid=1052772 |title=Sequence organization of the human genome |journal=Cell |volume=6 |issue=3 |pages=345–58 |year=1975 |last1=Schmid |first1=Carl W |last2=Deininger |first2=Prescott L |s2cid=42804857 }}</ref> ''Alu'' elements are the most abundant transposable elements in the human genome, present in excess of one million copies.<ref name="pmid9694261">{{cite journal |doi=10.1002/elps.1150190806 |pmid=9694261 |title=Effects of ''Alu'' insertions on gene function |journal=Electrophoresis |volume=19 |issue=8–9 |pages=1260–4 |year=1998 |last1=Szmulewicz |first1=Martin N |last2=Novick |first2=Gabriel E |last3=Herrera |first3=Rene J |s2cid=45917758 }}</ref> Most ''Alu'' elements are thought to be selfish or parasitic DNA. However, it has been suggested that at least some are likely to play a role in evolution and have been used as genetic markers.<ref name=pmid11263730>{{cite journal |doi=10.1554/0014-3820(2001)055[0001:ptepda]2.0.co;2 |pmid=11263730 |title=Perspective: Transposable Elements, Parasitic Dna, and Genome Evolution |journal=Evolution |volume=55 |issue=1 |pages=1–24 |year=2001 |last1=Kidwell |first1=Margaret G |last2=Lisch |first2=Damon R |s2cid=25273865 }}</ref><ref name="Pray">{{cite web |last1=Pray |first1=Leslie |title=Functions and Utility of Alu Jumping Genes |url=https://www.nature.com/scitable/topicpage/functions-and-utility-of-alu-jumping-genes-561 |website=Scitable.com |publisher=Nature |access-date=26 June 2019 |date=2008}}</ref> They are derived from the small cytoplasmic 7SL RNA, a component of the signal recognition particle. ''Alu'' elements are not highly conserved within primate genomes, as only a minority have retained activity, and originated in the genome of an ancestor of Supraprimates.<ref name=pmid17307271>{{cite journal |doi=10.1016/j.tig.2007.02.002 |pmid=17307271 |title=Evolutionary history of 7SL RNA-derived SINEs in Supraprimates |journal=Trends in Genetics |volume=23 |issue=4 |pages=158–61 |year=2007 |last1=Kriegs |first1=Jan Ole |last2=Churakov |first2=Gennady |last3=Jurka |first3=Jerzy |last4=Brosius |first4=Jürgen |last5=Schmitz |first5=Jürgen }}</ref>
''Alu'' insertions have been implicated in several inherited human diseases and in various forms of cancer.
The study of Alu elements has also been important in elucidating human population genetics and the evolution of primates, including the evolution of humans.
[[File:PLoSBiol3.5.Fig7ChromosomesAluFish.jpg|thumb|300px|Karyotype from a female human lymphocyte (46, XX). Chromosomes were hybridized with a probe for Alu elements (green) and counterstained with TOPRO-3 (red). Alu elements were used as a marker for chromosomes and chromosome bands rich in genes.]]
== <span id="The Alu family"></span>Alu family == The Alu family is a family of repetitive elements in primate genomes, including the human genome.<ref>{{Cite journal|last1=Arcot|first1=Santosh S.|last2=Wang|first2=Zhenyuan|last3=Weber|first3=James L.|last4=Deininger|first4=Prescott L.|last5=Batzer|first5=Mark A.|date=September 1995|title=Alu Repeats: A Source for the Genesis of Primate Microsatellites|journal=Genomics|volume=29|issue=1|pages=136–144|doi=10.1006/geno.1995.1224|pmid=8530063|issn=0888-7543}}</ref> Modern ''Alu'' elements are about 300 base pairs long and are therefore classified as short interspersed nuclear elements (SINEs) among the class of repetitive RNA elements. The typical structure is 5' - Part A - A5TACA6 - Part B - PolyA Tail - 3', where Part A and Part B (also known as "left arm" and "right arm") are similar nucleotide sequences. Expressed another way, it is believed modern ''Alu'' elements emerged from a head to tail fusion of two distinct FAMs (fossil antique monomers) over 100 million years ago, hence its dimeric structure of two similar, but distinct monomers (left and right arms) joined by an A-rich linker. Both monomers are thought to have evolved from 7SL, also known as SRP RNA.<ref name=pmid17020921>{{cite journal |doi=10.1093/nar/gkl706 |pmid=17020921 |pmc=1636486 |title=Alu elements as regulators of gene expression |journal=Nucleic Acids Research |volume=34 |issue=19 |pages=5491–7 |year=2006 |last1=Häsler |first1=Julien |last2=Strub |first2=Katharina }}</ref> The length of the polyA tail varies between ''Alu'' families.
There are over one million ''Alu'' elements interspersed throughout the human genome, and it is estimated that about 10.7% of the human genome consists of ''Alu'' sequences. However, less than 0.5% are polymorphic (i.e., occurring in more than one form or morph).<ref name=pmid11560904>{{cite journal |pmid=11560904 |pmc=1461783 |year=2001 |last1=Roy-Engel |first1=A. M |title=Alu insertion polymorphisms for the study of human genomic diversity |journal=Genetics |volume=159 |issue=1 |pages=279–90 |last2=Carroll |first2=M. L |last3=Vogel |first3=E |last4=Garber |first4=R. K |last5=Nguyen |first5=S. V |last6=Salem |first6=A. H |last7=Batzer |first7=M. A |last8=Deininger |first8=P. L |doi=10.1093/genetics/159.1.279 }}</ref> In 1988, Jerzy Jurka and Temple Smith discovered that ''Alu'' elements were split in two major subfamilies known as AluJ (named after Jurka) and AluS (named after Smith), and other Alu subfamilies were also independently discovered by several groups.<ref name=pmid3387438>{{cite journal |doi=10.1073/pnas.85.13.4775 |pmid=3387438 |pmc=280518 |title=A fundamental division in the Alu family of repeated sequences |journal=Proceedings of the National Academy of Sciences |volume=85 |issue=13 |pages=4775–8 |year=1988 |last1=Jurka |first1=J |last2=Smith |first2=T |bibcode=1988PNAS...85.4775J |doi-access=free }}</ref> Later on, a sub-subfamily of AluS which included active Alu elements was given the separate name AluY. Dating back 65 million years, the AluJ lineage is the oldest and least active in the human genome. The younger AluS lineage is about 30 million years old and still contains some active elements. Finally, the AluY elements are the youngest of the three and have the greatest disposition to move along the human genome.<ref name=pmid18836035>{{cite journal |doi=10.1101/gr.081737.108 |pmid=18836035 |pmc=2593586 |title=Active Alu retrotransposons in the human genome |journal=Genome Research |volume=18 |issue=12 |pages=1875–83 |year=2008 |last1=Bennett |first1=E. A |last2=Keller |first2=H |last3=Mills |first3=R. E |last4=Schmidt |first4=S |last5=Moran |first5=J. V |last6=Weichenrieder |first6=O |last7=Devine |first7=S. E }}</ref> The discovery of ''Alu'' subfamilies led to the hypothesis of master/source genes, and provided the definitive link between transposable elements (active elements) and interspersed repetitive DNA (mutated copies of active elements).<ref name=pmid1774786>{{cite journal |doi=10.1007/bf02102862 |pmid=1774786 |title=Evolution of the master Alu gene(s) |journal=Journal of Molecular Evolution |volume=33 |issue=4 |pages=311–20 |year=1991 |last1=Richard Shen |first1=M |last2=Batzer |first2=Mark A |last3=Deininger |first3=Prescott L |bibcode=1991JMolE..33..311R |s2cid=13091552 }}</ref>
=== Related elements === B1 elements in rats and mice are similar to Alus in that they also evolved from 7SL RNA, but they only have one left monomer arm. 95% percent of human Alus are also found in chimpanzees, and 50% of B elements in mice are also found in rats. These elements are mostly found in introns and upstream regulatory elements of genes.<ref>{{cite journal |last1=Tsirigos |first1=Aristotelis |last2=Rigoutsos |first2=Isidore |last3=Stormo |first3=Gary D. |title=Alu and B1 Repeats Have Been Selectively Retained in the Upstream and Intronic Regions of Genes of Specific Functional Classes |journal=PLOS Computational Biology |date=18 December 2009 |volume=5 |issue=12 |article-number=e1000610 |doi=10.1371/journal.pcbi.1000610 |pmid=20019790 |pmc=2784220|bibcode=2009PLSCB...5E0610T |doi-access=free }}</ref>
The ancestral form of Alu and B1 is the fossil Alu monomer (FAM). Free-floating forms of the left and right arms exist, termed free left Alu monomers (FLAMs) and free right Alu monomers (FRAMs) respectively.<ref>{{cite journal |last1=Kojima |first1=K. K. |title=Alu Monomer Revisited: Recent Generation of Alu Monomers |journal=Molecular Biology and Evolution |date=16 August 2010 |volume=28 |issue=1 |pages=13–15 |doi=10.1093/molbev/msq218 |pmid=20713470|doi-access=free }}</ref> A notable FLAM in primates is the BC200 lncRNA.
=={{anchor|7SL RNA}}Sequence features== [[File:LINE1s and SINEs.png|thumb|Genetic structure of murine LINE1 and SINEs, including Alu.]]
Two main promoter "boxes" are found in Alu: a 5' A box with the consensus {{tt|TGGCTCACGCC}}, and a 3' B box with the consensus {{tt|GTTCGAGAC}} (IUPAC nucleic acid notation). tRNAs, which are transcribed by RNA polymerase III, have a similar but stronger promoter structure.<ref>{{cite journal |last1=Conti |first1=A |last2=Carnevali |first2=D |last3=Bollati |first3=V |last4=Fustinoni |first4=S |last5=Pellegrini |first5=M |last6=Dieci |first6=G |title=Identification of RNA polymerase III-transcribed Alu loci by computational screening of RNA-Seq data. |journal=Nucleic Acids Research |date=January 2015 |volume=43 |issue=2 |pages=817–35 |doi=10.1093/nar/gku1361 |pmid=25550429 |pmc=4333407}}</ref> Both boxes are located in the left arm.<ref name=pmid17020921/>
Alu elements contain four or fewer Retinoic Acid response element hexamer sites in its internal promoter, with the last one overlapping with the "B box".<ref name=pmid7667273>{{cite journal |doi=10.1073/pnas.92.18.8229 |pmid=7667273 |pmc=41130 |title=The consensus sequence of a major Alu subfamily contains a functional retinoic acid response element |journal=Proceedings of the National Academy of Sciences |volume=92 |issue=18 |pages=8229–33 |year=1995 |last1=Vansant |first1=G |last2=Reynolds |first2=W. F |bibcode=1995PNAS...92.8229V |doi-access=free }}</ref> In this 7SL (SRP) RNA example below, functional hexamers are underlined using a solid line, with the non-functional third hexamer denoted using a dotted line:
{{tt|1=<span style="line-break: anywhere">GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGG<u>AGGCTG</u>AGGCTGGA<u>GGATCG</u>CTTG<u style="text-decoration-style: dotted;">AGTCCA</u>GG'''<u>AGTTCT</u>GGGCT'''GTAGTGCGCTATGCCGATCGGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTC</span>}}.
The recognition sequence of the ''Alu I'' endonuclease is 5' ag/ct 3'; that is, the enzyme cuts the DNA segment between the guanine and cytosine residues (in lowercase above).<ref>{{cite journal | journal=Nature | date=1984 | volume=312 |issue=5990 | pages=171–2 | title=Alu sequences are processed 7SL RNA genes | author=Ullu E, Tschudi C | pmid= 6209580| doi=10.1038/312171a0 | bibcode=1984Natur.312..171U | s2cid=4328237 }}</ref>
==Alu elements==
Some ''Alu'' elements are responsible for regulation of tissue-specific genes. Others are involved in the transcription of nearby genes and can sometimes change the way a gene is expressed.<ref name=pmid8790336>{{cite journal |pmid=8790336 |pmc=38434 |year=1996 |last1=Britten |first1=R. J |title=DNA sequence insertion and evolutionary variation in gene regulation |journal=Proceedings of the National Academy of Sciences of the United States of America |volume=93 |issue=18 |pages=9374–7 |doi=10.1073/pnas.93.18.9374|bibcode=1996PNAS...93.9374B |doi-access=free }}</ref>
''Alu'' elements are retrotransposons and look like DNA copies made from RNA polymerase III-encoded RNAs. ''Alu'' elements do not encode for protein products. They are replicated as any other DNA sequence, but depend on LINE retrotransposons for generation of new elements, thus providing an easy explanation for their presence in large numbers in primate genomes.<ref name=pmid16344113>{{cite journal |doi=10.1016/S0074-7696(05)47004-7 |pmid=16344113 |title=Short Retroposons in Eukaryotic Genomes |journal=International Review of Cytology |volume=247 |pages=165–221 |year=2005 |last1=Kramerov |first1=D |last2=Vassetzky |first2=N }}</ref>
''Alu'' element replication and mobilization begins by interactions with signal recognition particles (SRPs), which aid newly translated proteins to reach their final destinations.<ref name=pmid11089964>{{cite journal |doi=10.1038/35041507 |pmid=11089964 |title=Structure and assembly of the Alu domain of the mammalian signal recognition particle |journal=Nature |volume=408 |issue=6809 |pages=167–73 |year=2000 |last1=Weichenrieder |first1=Oliver |last2=Wild |first2=Klemens |last3=Strub |first3=Katharina |last4=Cusack |first4=Stephen |bibcode=2000Natur.408..167W |s2cid=4427070 |url=http://archive-ouverte.unige.ch/unige:17516 }}</ref> ''Alu'' RNA forms a specific RNA:protein complex with a protein heterodimer consisting of SRP9 and SRP14.<ref name="pmid11089964"/> SRP9/14 facilitates ''Alu''<nowiki/>'s attachment to ribosomes that capture nascent L1 proteins. Thus, an ''Alu'' element can take control of the L1 protein's reverse transcriptase, ensuring that the ''Alu''<nowiki/>'s RNA sequence gets copied into the genome rather than the L1's mRNA.<ref name="pmid18836035"/>
''Alu'' elements in primates form a fossil record that is relatively easy to decipher because ''Alu'' element insertion events have a characteristic signature that is both easy to read and faithfully recorded in the genome from generation to generation. The study of ''Alu Y'' elements (the more recently evolved) thus reveals details of ancestry because individuals will most likely only share a particular ''Alu'' element insertion if they have a common ancestor. This is because insertion of an Alu element occurs only 100 - 200 times per million years, and no known mechanism for the targeted deletion of one has been found. Therefore, individuals with an element likely descended from an ancestor with one—and vice versa, for those without. In genetics, the presence or lack thereof of a recently inserted ''Alu'' element may be a good property to consider when studying human evolution.<ref>{{Cite journal|last1=Terreros|first1=Maria C.|last2=Alfonso-Sanchez|first2=Miguel A.|last3=Novick|last4=Luis|last5=Lacau|last6=Lowery|last7=Regueiro|last8=Herrera|date=September 11, 2009|title=Insights on human evolution: an analysis of Alu insertion polymorphisms|journal=Journal of Human Genetics|volume=54|issue=10|pages=603–611|doi=10.1038/jhg.2009.86|pmid=19745832|s2cid=8153502|doi-access=free}}</ref> Most human ''Alu'' element insertions can be found in the corresponding positions in the genomes of other primates, but about 7,000 ''Alu'' insertions are unique to humans.<ref name=pmid16136131>{{cite journal |doi=10.1038/nature04072 |pmid=16136131 |title=Initial sequence of the chimpanzee genome and comparison with the human genome |journal=Nature |volume=437 |issue=7055 |pages=69–87 |year=2005 |bibcode=2005Natur.437...69. |author1=Chimpanzee Sequencing Analysis Consortium |s2cid=2638825 |doi-access=free }}</ref>
== Impact in humans ==
Some ''Alu'' elements have been proposed to affect gene expression and been found to contain functional promoter regions for steroid hormone receptors.<ref name=pmid7667273/><ref name=pmid7559405>{{cite journal |pmid=7559405 |year=1995 |last1=Norris |first1=J |title=Identification of a new subclass of Alu DNA repeats that can function as estrogen receptor-dependent transcriptional enhancers |journal=The Journal of Biological Chemistry |volume=270 |issue=39 |pages=22777–82 |last2=Fan |first2=D |last3=Aleman |first3=C |last4=Marks |first4=J. R |last5=Futreal |first5=P. A |last6=Wiseman |first6=R. W |last7=Iglehart |first7=J. D |last8=Deininger |first8=P. L |last9=McDonnell |first9=D. P |doi=10.1074/jbc.270.39.22777|s2cid=45796017 |doi-access=free }}</ref> Due to the abundant content of CpG dinucleotides found in ''Alu'' elements, these regions can serve as a site of methylation, contributing to up to 30% of the methylation sites in the human genome.<ref name=pmid9753719>{{cite journal |doi=10.1093/nar/26.20.4541 |pmid=9753719 |pmc=147893 |title=Does SINE evolution preclude Alu function? |journal=Nucleic Acids Research |volume=26 |issue=20 |pages=4541–50 |year=1998 |last1=Schmid |first1=C. W }}</ref> ''Alu'' elements are also a common source of mutations in humans; however, such mutations are often confined to non-coding regions of pre-mRNA (introns), where they have little discernible impact on the bearer.<ref name=pmid11237011>{{cite journal |doi=10.1038/35057062 |pmid=11237011 |title=Initial sequencing and analysis of the human genome |journal=Nature |volume=409 |issue=6822 |pages=860–921 |year=2001 |last1=Lander |first1=Eric S |last2=Linton |first2=Lauren M |last3=Birren |first3=Bruce |last4=Nusbaum |first4=Chad |last5=Zody |first5=Michael C |last6=Baldwin |first6=Jennifer |last7=Devon |first7=Keri |last8=Dewar |first8=Ken |last9=Doyle |first9=Michael |last10=Fitzhugh |first10=William |last11=Funke |first11=Roel |last12=Gage |first12=Diane |last13=Harris |first13=Katrina |last14=Heaford |first14=Andrew |last15=Howland |first15=John |last16=Kann |first16=Lisa |last17=Lehoczky |first17=Jessica |last18=Levine |first18=Rosie |last19=McEwan |first19=Paul |last20=McKernan |first20=Kevin |last21=Meldrim |first21=James |last22=Mesirov |first22=Jill P |last23=Miranda |first23=Cher |last24=Morris |first24=William |last25=Naylor |first25=Jerome |last26=Raymond |first26=Christina |last27=Rosetti |first27=Mark |last28=Santos |first28=Ralph |last29=Sheridan |first29=Andrew |last30=Sougnez |first30=Carrie |display-authors=29 |bibcode=2001Natur.409..860L |url=https://deepblue.lib.umich.edu/bitstream/2027.42/62798/1/409860a0.pdf }}</ref> Mutations in the introns (or non-coding regions of RNA) have little or no effect on phenotype of an individual if the coding portion of individual's genome does not contain mutations. When Alu insertions occur in coding regions (exons), or into mRNA after the process of splicing, they're typically detrimental to the host organism.<ref name=pmid10381326>{{cite journal |doi=10.1006/mgme.1999.2864 |pmid=10381326 |title=Alu Repeats and Human Disease |journal=Molecular Genetics and Metabolism |volume=67 |issue=3 |pages=183–93 |year=1999 |last1=Deininger |first1=Prescott L |last2=Batzer |first2=Mark A |s2cid=15651921 }}</ref>
However, the variation generated can be used in studies of the movement and ancestry of human populations,<ref name=pmid11988762>{{cite journal |doi=10.1038/nrg798 |pmid=11988762 |title=Alu Repeats and Human Genomic Diversity |journal=Nature Reviews Genetics |volume=3 |issue=5 |pages=370–9 |year=2002 |last1=Batzer |first1=Mark A |last2=Deininger |first2=Prescott L |s2cid=205486422 }}</ref> and the mutagenic effect of ''Alu''<ref name=pmid21282640>{{cite journal |doi=10.1073/pnas.1012834108 |pmid=21282640 |pmc=3041063 |title=Widespread establishment and regulatory impact of Alu exons in human genes |journal=Proceedings of the National Academy of Sciences |volume=108 |issue=7 |pages=2837–42 |year=2011 |last1=Shen |first1=S |last2=Lin |first2=L |last3=Cai |first3=J. J |last4=Jiang |first4=P |last5=Kenkel |first5=E. J |last6=Stroik |first6=M. R |last7=Sato |first7=S |last8=Davidson |first8=B. L |last9=Xing |first9=Y |bibcode=2011PNAS..108.2837S |doi-access=free }}</ref> and retrotransposons in general<ref name=pmid19763152>{{cite journal |doi=10.1038/nrg2640 |pmid=19763152 |pmc=2884099 |title=The impact of retrotransposons on human genome evolution |journal=Nature Reviews Genetics |volume=10 |issue=10 |pages=691–703 |year=2009 |last1=Cordaux |first1=Richard |last2=Batzer |first2=Mark A }}</ref> has played a major role in the evolution of the human genome. There are also a number of cases where ''Alu'' insertions or deletions are associated with specific effects in humans:
=== Associations with human disease === ''Alu'' insertions are sometimes disruptive and can result in inherited disorders. However, most ''Alu'' variation acts as markers that segregate with the disease so the presence of a particular ''Alu'' allele does not mean that the carrier will definitely get the disease. The first report of ''Alu''-mediated recombination causing a prevalent inherited predisposition to cancer was a 1995 report about ''hereditary nonpolyposis colorectal cancer''.<ref name=pmid7584997>{{cite journal |doi=10.1038/nm1195-1203 |pmid=7584997 |title=Founding mutations and Alu-mediated recombination in hereditary colon cancer |journal=Nature Medicine |volume=1 |issue=11 |pages=1203–6 |year=1995 |last1=Nyström-Lahti |first1=Minna |last2=Kristo |first2=Paula |last3=Nicolaides |first3=Nicholas C |last4=Chang |first4=Sheng-Yung |last5=Aaltonen |first5=Lauri A |last6=Moisio |first6=Anu-Liisa |last7=Järvinen |first7=Heikki J |last8=Mecklin |first8=Jukka-Pekka |last9=Kinzler |first9=Kenneth W |last10=Vogelstein |first10=Bert |last11=de la Chapelle |first11=Albert |last12=Peltomäki |first12=Päivi |s2cid=39468812 }}</ref> In the human genome, the most recently active have been the 22 AluY and 6 AluS Transposon Element subfamilies due to their inherited activity to cause various cancers. Thus due to their major heritable damage it is important to understand the causes that affect their transpositional activity.<ref name=pmid29219079>{{cite journal |doi=10.1186/s12864-017-4227-z |pmid=29219079 |pmc=5773891 |title=Computational identification of harmful mutation regions to the activity of transposable elements |journal=BMC Genomics |volume=18 |issue=Suppl 9 |page=862 |year=2017 |last1=Jin |first1=Lingling |last2=McQuillan |first2=Ian |last3=Li |first3=Longhai |doi-access=free }}</ref>
The following human diseases have been linked with ''Alu'' insertions:<ref name=pmid11988762/><ref name=pmid22204421>{{cite journal |doi=10.1186/gb-2011-12-12-236 |pmid=22204421 |pmc=3334610 |title=Alu elements: Know the SINEs |journal=Genome Biology |volume=12 |issue=12 |page=236 |year=2011 |last1=Deininger |first1=Prescott |doi-access=free }}</ref> * Alport syndrome * Breast cancer * chorioretinal degeneration * Diabetes mellitus type II * Ewing's sarcoma * Familial hypercholesterolemia * Hemophilia * Leigh syndrome * mucopolysaccharidosis VII * Neurofibromatosis * Macular degeneration<ref name="pnas">{{Cite journal |last1=Fukuda |first1=Shinichi |last2=Varshney |first2=Akhil |last3=Fowler |first3=Benjamin J. |last4=Wang |first4=Shao-bin |last5=Narendran |first5=Siddharth |last6=Ambati |first6=Kameshwari |last7=Yasuma |first7=Tetsuhiro |last8=Magagnoli |first8=Joseph |last9=Leung |first9=Hannah |last10=Hirahara |first10=Shuichiro |last11=Nagasaka |first11=Yosuke |date=2021-02-09 |title=Cytoplasmic synthesis of endogenous Alu complementary DNA via reverse transcription and implications in age-related macular degeneration |journal=Proceedings of the National Academy of Sciences |language=en |volume=118 |issue=6 |article-number=e2022751118 |doi=10.1073/pnas.2022751118 |pmid=33526699 |pmc=8017980 |bibcode=2021PNAS..11822751F |s2cid=231761522 |issn=0027-8424|doi-access=free }}</ref>
And the following diseases have been associated with single-nucleotide DNA variations in Alu elements affecting transcription levels:<ref>{{cite web |url=http://www.snpedia.com/index.php/Rs2333227 |work=SNPedia |title=SNP in the promoter region of the myeloperoxidase MPO gene |access-date=2010-03-14 |archive-url=https://web.archive.org/web/20100521053826/http://www.snpedia.com/index.php/Rs2333227 |archive-date=2010-05-21 }}{{MEDRS|date=December 2017}}</ref> * Alzheimer's disease * Lung cancer * Gastric cancer
The following disease have been associated with repeat expansion of AAGGG pentamere in Alu element : * RFC1 mutation responsible of CANVAS (Cerebellar Ataxia, Neuropathy & Vestibular Areflexia Syndrome) <ref>{{cite journal |title=Biallelic expansion of an intronic repeat in RFC1 is a common cause of late-onset ataxia |journal=Nat Genet |year=2019 |pmid=30926972|pmc=6709527|last1=Cortese |first1=A. |last2=Simone |first2=R. |last3=Sullivan |first3=R. |last4=Vandrovcova |first4=J. |last5=Tariq |first5=H. |last6=Yau |first6=W. Y. |last7=Humphrey |first7=J. |last8=Jaunmuktane |first8=Z. |last9=Sivakumar |first9=P. |last10=Polke |first10=J. |last11=Ilyas |first11=M. |last12=Tribollet |first12=E. |last13=Tomaselli |first13=P. J. |last14=Devigili |first14=G. |last15=Callegari |first15=I. |last16=Versino |first16=M. |last17=Salpietro |first17=V. |last18=Efthymiou |first18=S. |last19=Kaski |first19=D. |last20=Wood |first20=N. W. |last21=Andrade |first21=N. S. |last22=Buglo |first22=E. |last23=Rebelo |first23=A. |last24=Rossor |first24=A. M. |last25=Bronstein |first25=A. |last26=Fratta |first26=P. |last27=Marques |first27=W. J. |last28=Züchner |first28=S. |last29=Reilly |first29=M. M. |last30=Houlden |first30=H. |volume=51 |issue=4 |pages=649–658 |doi=10.1038/s41588-019-0372-4 }}</ref>
=== Associated human mutations === * The ''ACE'' gene, encoding angiotensin-converting enzyme, has 2 common variants, one with an ''Alu'' insertion (''ACE''-I) and one with the ''Alu'' deleted (''ACE''-D). This variation has been linked to changes in sporting ability: the presence of the ''Alu'' element is associated with better performance in endurance-oriented events (e.g. triathlons), whereas its absence is associated with strength- and power-oriented performance.<ref name=pmid21615186>{{cite journal |doi=10.2165/11588720-000000000-00000 |pmid=21615186 |title=The ACE Gene and Human Performance |journal=Sports Medicine |volume=41 |issue=6 |pages=433–48 |year=2011 |last1=Puthucheary |first1=Zudin |last2=Skipworth |first2=James RA |last3=Rawal |first3=Jai |last4=Loosemore |first4=Mike |last5=Van Someren |first5=Ken |last6=Montgomery |first6=Hugh E |s2cid=42531424 }}</ref> * The opsin gene duplication which resulted in the re-gaining of trichromacy in Old World primates (including humans) is flanked by an ''Alu'' element,<ref name=pmid10413401>{{cite journal |pmid=10413401 |url=http://genome.cshlp.org/cgi/pmidlookup?view=long&pmid=10413401 |year=1999 |last1=Dulai |first1=K. S |title=The evolution of trichromatic color vision by opsin gene duplication in New World and Old World primates |journal=Genome Research |volume=9 |issue=7 |pages=629–38 |last2=von Dornum |first2=M |last3=Mollon |first3=J. D |last4=Hunt |first4=D. M |doi=10.1101/gr.9.7.629|s2cid = 10637615|doi-access=free }}</ref> implicating the role of ''Alu'' in the evolution of three colour vision.
== References == {{Reflist|2}}
==External links== * {{MeshName|Alu+Repetitive+Sequences}} * {{cite journal |url=https://www.ncbi.nlm.nih.gov/nuccore/NR_002715.1 |title=NCBI Genbank DNA encoding 7SL RNA |date=2018-05-12|journal =National Center for Biotechnology Information}}
{{Repeated sequence}}
{{DEFAULTSORT:Alu Sequence}} Category:Repetitive DNA sequences Category:Human genetics