# Subgenomic mRNA

> Mediated Wiki article. Canonical URL: https://mediated.wiki/source/Subgenomic_mRNA
> Markdown URL: https://mediated.wiki/source/Subgenomic_mRNA.md
> Source: https://en.wikipedia.org/wiki/Subgenomic_mRNA
> Source revision: 1329314719
> License: Creative Commons Attribution-ShareAlike 4.0 International (https://creativecommons.org/licenses/by-sa/4.0/)

{{Short description|Concept in genetics}}
{{about||the data structure|nested set model}}

'''Subgenomic [mRNA](/source/mRNA)'''s are essentially smaller sections of the original transcribed [template strand](/source/template_strand).

==3' to 5' DNA or RNA==
During [transcription](/source/Transcription_(genetics)), the original template strand is usually read from the [3'](/source/3') to the [5'](/source/5') end from beginning to end.  Subgenomic mRNAs are created when transcription begins at the 3' end of the template strand (or 5' of the to-be-newly synthesized template) and begins to copy towards the 5' end of the template strand before "jumping" to the end of the template and copying the last nucleotides of the 5' end of the template, (finishing the 3' tail for the newly created strand).

As a result, the translated strand will have a similar 5' end to varying degrees with the original template (depending on which part of the template the transcription jumped over) and a similar 3' end to the template.<ref name="pmid18034156">{{cite journal | vauthors = Wu B, White KA | title = Uncoupling RNA virus replication from transcription via the polymerase: functional and evolutionary insights | journal = The EMBO Journal | volume = 26 | issue = 24 | pages = 5120–30 | date = December 2007 | pmid = 18034156 | pmc = 2140117 | doi = 10.1038/sj.emboj.7601931 }}</ref>

==5' to 3' (positive sense) viral RNA==
Positive-sense (5' to 3') viral RNA which may be directly translated into the desired viral proteins, undergoes a similar process as described in 3' to 5'. Portions of the viral RNA may be skipped during translation.

==Result==
The result is that many different [proteins](/source/proteins) can be created from the same mRNA strand, with similar 5' ends (to varying degrees) and same 3' ends. Or, different proteins can be created with positive sense viral RNA.

The 5' section on the newly created strand matches that of the template strand, and this section on the template strand is referred to as the "nested set".<ref>{{cite journal | last1 = Le | first1 = TM | last2 = Wong | first2 = HH | last3 = Tay | first3 = FP | last4 = Fang | first4 = S | last5 = Keng | first5 = CT | last6 = Tan | first6 = YJ | last7 = Liu | first7 = DX | date = Aug 2007 | title = Expression, post-translational modification and biochemical characterization of proteins encoded by subgenomic mRNA8 of the severe acute respiratory syndrome coronavirus | pmid = 17645546  | journal = FEBS J | volume = 274 | issue = 16| pages = 4211–22 |  pmc=7164070 |doi=10.1111/j.1742-4658.2007.05947.x| doi-access = free }}</ref>

<pre>
3'                                                          5'
 GCCGCCCCGTATCGATCGTAGCGCACGTTATATATACGTTATTTCTGCGCGGAAAAAAAAA - Original template Strand
 
5'                                                          3'
 GCCGCCCCGTATCGATCGTAGCGCACGTTATATATAC---------------AAAAAAAAA      |
 GCCGCCCCGTATCGATCGTAGCGCAC--------------------------AAAAAAAAA      | = Subgenomic mRNA. 
 GCCGCCCCGTAT----------------------------------------AAAAAAAAA      |
 
 GCCGCCCCGTAT = Nested Set  - indicates jumps.
</pre>

== Examples ==

This complex method of transcription is generally restricted to [virus](/source/virus)es, especially those of the single-stranded, positive-sense [RNA](/source/RNA) or Class IV viruses using the [Baltimore Classification System](/source/Baltimore_Classification_System), e.g. viruses of the order [Nidovirales](/source/Nidovirales).

It is primarily used for compacting more [genetic](/source/Genetics) information into a shorter amount of genetic material.<ref name="pmid17988704">{{cite journal | vauthors = Xu W, White KA | title = Subgenomic mRNA transcription in an aureusvirus: down-regulation of transcription and evolution of regulatory RNA elements | journal = Virology | volume = 371 | issue = 2 | pages = 430–8 | date = February 2008 | pmid = 17988704 | doi = 10.1016/j.virol.2007.09.035 | doi-access = free }}</ref>

== Literature ==
{{reflist}}

{{Nucleic acids}}

Category:RNA

---
Adapted from the Wikipedia article [Subgenomic mRNA](https://en.wikipedia.org/wiki/Subgenomic_mRNA) by Wikipedia contributors ([contributor history](https://en.wikipedia.org/wiki/Subgenomic_mRNA?action=history)). Available under [Creative Commons Attribution-ShareAlike 4.0 International](https://creativecommons.org/licenses/by-sa/4.0/). Changes may have been made.
